Stem-loop sequence ptc-MIR171i

AccessionMI0002285 (change log)
DescriptionPopulus trichocarpa miR171i stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

6 open access papers mention ptc-MIR171i
(11 sentences)

Stem-loop
        a  au         c       c       --    c uc       agugucuuucuucuuc 
5' gagug cu  gauauuggc ugguuca ucagauc  acga u  agagcaa                u
   ||||| ||  ||||||||| ||||||| |||||||  |||| |  |||||||                 
3' cucau ga  cuauaaccg gccgagu aguuuag  ugcu g  uuuuguu                u
        -  cu         u       u       uu    u ua       cuucuucuucuuuuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000341.2: 7776851-7776985 [+]
intergenic
Database links

Mature sequence ptc-miR171i

Accession MIMAT0001991
Sequence

106 - 

ugauugagccgugccaauauc

 - 126

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).
2
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
3
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).