Stem-loop sequence ptc-MIR171g

AccessionMI0002283 (change log)
DescriptionPopulus trichocarpa miR171g stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

6 open access papers mention ptc-MIR171g
(11 sentences)

Stem-loop
   -ga     ggg        g            u  c   ucu     auu 
5'    aagug   gauguugg auggcucaauca gu aaa   cccaa   a
      |||||   |||||||| |||||||||||| || |||   |||||   u
3'    uucac   cuauaacc ugccgaguuagu ua uuu   ggguu   g
   uuc     --a        g            c  a   ucu     gua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000348.2: 11044609-11044708 [+]
intergenic
Database links

Mature sequence ptc-miR171g-5p

Accession MIMAT0022902
Sequence

13 - 

uguugggauggcucaaucaug

 - 33

Get sequence
Evidence experimental; miRNAseq [3]

Mature sequence ptc-miR171g-3p

Accession MIMAT0001989
Previous IDsptc-miR171g
Sequence

71 - 

ugauugagccgugccaauauc

 - 91

Get sequence
Evidence experimental; cloned [1], miRNAseq [3]

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).
2
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).
3
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).