Stem-loop sequence ptc-MIR171c

AccessionMI0002279 (change log)
DescriptionPopulus trichocarpa miR171c stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

6 open access papers mention ptc-MIR171c
(11 sentences)

Stem-loop
   aaa      c          a         c  a  -  -ga      c  ga 
5'    agaaag gauguuggug gguucaauc ga ga cg   uuuaca gu  a
      |||||| |||||||||| ||||||||| || || ||   |||||| ||  a
3'    ucuuuc cuauaaccgc ccgaguuag cu cu gc   aaaugu ua  g
   -ac      a          g         a  -  a  aua      -  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000342.2: 4686630-4686733 [-]
intergenic
Database links

Mature sequence ptc-miR171c

Accession MIMAT0001985
Sequence

75 - 

agauugagccgcgccaauauc

 - 95

Get sequence
Evidence by similarity; MI0002277

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).
2
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).