Stem-loop sequence ptc-MIR169y

AccessionMI0002275 (change log)
DescriptionPopulus trichocarpa miR169y stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

9 open access papers mention ptc-MIR169y
(12 sentences)

Stem-loop
   ucu    u   -     --ug     a       -cuu  aa       ug      cgagaua 
5'    uguu agu agcca    gauga uugccug    cc  aaugagg  ucaagc       a
      |||| ||| |||||    ||||| |||||||    ||  |||||||  ||||||        
3'    acag uca ucggu    cuacu gacggac    gg  uuacucc  aguuug       a
   --g    u   a     ucga     -       ccuu  gg       cu      aacauac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000341.2: 6551729-6551851 [+]
intergenic
Clustered miRNAs
< 10kb from ptc-MIR169y
ptc-MIR169afCM000341.2: 6547979-6548085 [-]
ptc-MIR169yCM000341.2: 6551729-6551851 [+]
ptc-MIR169acCM000341.2: 6551950-6552055 [+]
Database links

Mature sequence ptc-miR169y

Accession MIMAT0001981
Sequence

11 - 

uagccauggaugaauugccug

 - 31

Get sequence
Evidence by similarity; MI0000212

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).