Stem-loop sequence ptc-MIR169u

AccessionMI0002271 (change log)
DescriptionPopulus trichocarpa miR169u stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

9 open access papers mention ptc-MIR169u
(12 sentences)

Stem-loop
   gag       -       -   c    u      --u    -   ug   uc     ---a  aau 
5'    gguuggg uagccaa gga gacu gccuau   uccu cca  ggg  cugaa    ag   g
      ||||||| ||||||| ||| |||| ||||||   |||| |||  |||  |||||    ||   a
3'    ucaaucc aucgguu ccu cuga cggaua   ggga ggu  cuc  gacuu    uc   a
   ---       u       u   -    -      cuu    u   ua   ga     gcug  aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000351.2: 12074209-12074330 [+]
intergenic
Clustered miRNAs
< 10kb from ptc-MIR169u
ptc-MIR169uCM000351.2: 12074209-12074330 [+]
ptc-MIR169rCM000351.2: 12082579-12082697 [+]
Database links

Mature sequence ptc-miR169u-5p

Accession MIMAT0001977
Previous IDsptc-miR169u
Sequence

11 - 

uagccaaggacgacuugccua

 - 31

Get sequence
Evidence experimental; miRNAseq [2]

Mature sequence ptc-miR169u-3p

Accession MIMAT0022900
Sequence

97 - 

ggcagucuccuuuggcuaucc

 - 117

Get sequence
Evidence experimental; miRNAseq [2]

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).
2
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).