Stem-loop sequence ptc-MIR169s

AccessionMI0002269 (change log)
DescriptionPopulus trichocarpa miR169s stem-loop
Gene family MIPF0000037; MIR169_2
Stem-loop
   ag    ug  uc          ga         agca  u     ca   cucc        a 
5'   agug  au  agccaaggau  cuugccggc    gg aagag  aag    guuuuugg a
     ||||  ||  ||||||||||  |||||||||    || |||||  |||    ||||||||  
3'   ucau  ua  ucgguuccug  gaacggccg    cc uuuuc  uuc    uaggaacu g
   --    gu  ca          uc         ---g  -     aa   --ua        u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ptc-miR169s

Accession MIMAT0001975
Sequence

11 - 

ucagccaaggaugacuugccg

 - 31

Get sequence
Evidence by similarity; MI0000976

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).