Stem-loop sequence ptc-MIR169s

AccessionMI0002269
DescriptionPopulus trichocarpa miR169s stem-loop
Gene family MIPF0000037; MIR169_2
Stem-loop
ag    ug  uc          ga         agca  u     ca   cucc        a 
  agug  au  agccaaggau  cuugccggc    gg aagag  aag    guuuuugg a
  ||||  ||  ||||||||||  |||||||||    || |||||  |||    ||||||||  
  ucau  ua  ucgguuccug  gaacggccg    cc uuuuc  uuc    uaggaacu g
--    gu  ca          uc         ---g  -     aa   --ua        u 
Get sequence
Deep sequencing
11 reads, 12.6 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI_Poptr2.0) Overlapping transcripts
scaffold_18: 3350207-3350326 [-]
intergenic

Mature sequence ptc-miR169s

Accession MIMAT0001975
Sequence

11 - 

ucagccaaggaugacuugccg

 - 31

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence by similarity; MI0000976

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).