Stem-loop sequence ptc-MIR169q

AccessionMI0002267 (change log)
DescriptionPopulus trichocarpa miR169q stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

9 open access papers mention ptc-MIR169q
(12 sentences)

Stem-loop
   ucu    - g           c    u     -uu  ua c   uu   a      -  gg 
5'    uguu a uuagccaagga gacu gccug   cc  g aau  ggg uuugcc cu  a
      |||| | ||||||||||| |||| |||||   ||  | |||  ||| |||||| ||   
3'    acag u gaucgguuccu cuga cggac   gg  c uua  ccc ggacgg ga  c
   ---    u g           -    -     uuu  gc -   cu   a      a  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000337.2: 27741711-27741825 [+]
intergenic
Clustered miRNAs
< 10kb from ptc-MIR169q
ptc-MIR169qCM000337.2: 27741711-27741825 [+]
ptc-MIR169wCM000337.2: 27741955-27742063 [+]
Database links

Mature sequence ptc-miR169q

Accession MIMAT0001973
Sequence

11 - 

uagccaaggacgacuugccug

 - 31

Get sequence
Evidence by similarity; MI0000212

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).