Stem-loop sequence ptc-MIR169n

AccessionMI0002264 (change log)
DescriptionPopulus trichocarpa miR169n stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

9 open access papers mention ptc-MIR169n
(15 sentences)

Stem-loop
   ag      uuu            a        -a  u  augg      c  c  a 
5'   agugga   gagccaaggaug cuugccgc  ga gc    uccuug ug ug u
     ||||||   |||||||||||| ||||||||  || ||    |||||| || ||  
3'   ucgcuu   cuugguuccuac gaacggug  uu ug    gggaac au ac c
   --      ccu            -        gg  u  --gg      c  -  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ptc-miR169n-5p

Accession MIMAT0001970
Previous IDsptc-miR169n
Sequence

11 - 

ugagccaaggaugacuugccg

 - 31

Get sequence
Evidence experimental; miRNAseq [2]

Mature sequence ptc-miR169n-3p

Accession MIMAT0022899
Sequence

82 - 

gcaagcauccuugguucucc

 - 101

Get sequence
Evidence experimental; miRNAseq [2]

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).
2
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).