Stem-loop sequence ptc-MIR169l

AccessionMI0002262 (change log)
DescriptionPopulus trichocarpa miR169l stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

9 open access papers mention ptc-MIR169l
(14 sentences)

Stem-loop
   ucu    -uga          u    u     - -ua  u       aucauuaugcauaaauagaacgaaaua 
5'    uguu    uagccaagga gacu gccug c   ca acaagag                           u
      ||||    |||||||||| |||| ||||| |   || |||||||                           g
3'    acag    aucgguuccu cuga cggac g   gu uguucuc                           u
   ---    ucga          -    -     c uug  u       aaaagugacguaauuaauuaugguaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000353.2: 7526169-7526311 [-]
intergenic
Clustered miRNAs
< 10kb from ptc-MIR169l
ptc-MIR169mCM000353.2: 7526473-7526591 [-]
ptc-MIR169lCM000353.2: 7526169-7526311 [-]
Database links

Mature sequence ptc-miR169l

Accession MIMAT0001968
Sequence

11 - 

uagccaaggaugacuugccug

 - 31

Get sequence
Evidence by similarity; MI0000212

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).