Stem-loop sequence ptc-MIR169k

AccessionMI0002261 (change log)
DescriptionPopulus trichocarpa miR169k stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

9 open access papers mention ptc-MIR169k
(12 sentences)

Stem-loop
   ucu     g  -          g      cu u      ccuc      augaacacgagcauuuauguggugcucaaaagaaaaggagagaaugaucccag 
5'    uguuu gu agccaaggau acuugc  g agccuc    ggauuc                                                     c
      ||||| || |||||||||| ||||||  | ||||||    ||||||                                                     u
3'    gcaga ca ucgguuccug ugaacg  c uuggag    ccuaag                                                     g
   --g     g  a          -      ac c      aaca      aucgauauuuaguggacgaagagcgaugaaguuaccuaacuggaacagcgacg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000339.2: 16015779-16015981 [-]
intergenic
Database links

Mature sequence ptc-miR169k

Accession MIMAT0001967
Sequence

11 - 

uagccaaggaugacuugccug

 - 31

Get sequence
Evidence by similarity; MI0000183

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).