Stem-loop sequence ptc-MIR169i

AccessionMI0002259 (change log)
DescriptionPopulus trichocarpa miR169i stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

9 open access papers mention ptc-MIR169i
(22 sentences)

Stem-loop
   ucuu   u   -         u    u     cuccauug    a      c    aa     g 
5'     guu ggu agccaagga gacu gccug        uagg gguuuc gaaa  augca a
       ||| ||| ||||||||| |||| |||||        |||| |||||| ||||  |||||  
3'     cag uca ucgguuccu cuga cggac        gucc ccaaag cuuu  uaugu c
   --gu   u   a         -    -     uuugcuuu    -      -    aa     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000337.2: 31302443-31302565 [-]
intergenic
Clustered miRNAs
< 10kb from ptc-MIR169i
ptc-MIR169iCM000337.2: 31302443-31302565 [-]
ptc-MIR169jCM000337.2: 31302159-31302295 [-]
Database links

Mature sequence ptc-miR169i

Accession MIMAT0001965
Sequence

11 - 

uagccaaggaugacuugccug

 - 31

Get sequence
Evidence by similarity; MI0000976

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).