Stem-loop sequence ptc-MIR169h

AccessionMI0002258 (change log)
DescriptionPopulus trichocarpa miR169h stem-loop
Gene family MIPF0000037; MIR169_2
Stem-loop
   ga       uc        au           ---------------   a gg     cag  cuu 
5'   guguaau  agccaagg  gacuugccggc               agc c  gaucu   ag   a
     |||||||  ||||||||  |||||||||||               ||| |  |||||   ||    
3'   cauguua  ucgguucc  uugaacggccg               ucg g  cuaga   uc   a
   --       ca        cg           gccuuuucauuacug   - aa     aga  aau 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000342.2: 26618429-26618546 [+]
intergenic
Database links

Mature sequence ptc-miR169h

Accession MIMAT0001964
Sequence

11 - 

cagccaaggaugacuugccgg

 - 31

Get sequence
Evidence by similarity; MI0000976

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).