Stem-loop sequence ptc-MIR169h

Accession MI0002258
Description Populus trichocarpa miR169h stem-loop
Gene family MIPF0000037; MIR169_2
Stem-loop
ga       uc        au           ---------------   a gg     cag  cuu 
  guguaau  agccaagg  gacuugccggc               agc c  gaucu   ag   a
  |||||||  ||||||||  |||||||||||               ||| |  |||||   ||    
  cauguua  ucgguucc  uugaacggccg               ucg g  cuaga   uc   a
--       ca        cg           gccuuuucauuacug   - aa     aga  aau 
Get sequence
Deep sequencing
9 reads, 23.9 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI_Poptr2.0) Overlapping transcripts
scaffold_6: 26618429-26618546 [+]
intergenic

Mature sequence ptc-miR169h

Accession MIMAT0001964
Sequence

11 - 

cagccaaggaugacuugccgg

 - 31

Get sequence
Deep sequencing 7 reads, 2 experiments
Evidence by similarity; MI0000976

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).