Stem-loop sequence ptc-MIR169f

Accession MI0002256
Description Populus trichocarpa miR169f stem-loop
Gene family MIPF0000037; MIR169_2
uuau  g u c     ag             aauaa    -      a   cuauagcuaugguauuuuucauccuagguuuggcuauauauauauauauauauagccaguuaauugcuau 
    gu g g agcca  gaugacuugccgg     gcua ugauca uag                                                                      a
    || | | |||||  |||||||||||||     |||| |||||| |||                                                                      a
    ca c c ucggu  cuacugaacggcu     ugau acuagu auc                                                                      a
--cu  a u a     cu             --aac    g      -   cuccaccuuguaguuguaaguuacuacacacacagacacacgucuguauauuuuguauuuacacgacucu 
Get sequence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI_Poptr2.0) Overlapping transcripts
scaffold_17: 12354617-12354855 [+]

Mature sequence ptc-miR169f

Accession MIMAT0001962

11 - 


 - 31

Get sequence
Evidence by similarity; MI0000212


PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).