Stem-loop sequence ptc-MIR169f

AccessionMI0002256
DescriptionPopulus trichocarpa miR169f stem-loop
Gene family MIPF0000037; MIR169_2
Stem-loop
uuau  g u c     ag             aauaa    -      a   cuauagcuaugguauuuuucauccuagguuuggcuauauauauauauauauauagccaguuaauugcuau 
    gu g g agcca  gaugacuugccgg     gcua ugauca uag                                                                      a
    || | | |||||  |||||||||||||     |||| |||||| |||                                                                      a
    ca c c ucggu  cuacugaacggcu     ugau acuagu auc                                                                      a
--cu  a u a     cu             --aac    g      -   cuccaccuuguaguuguaaguuacuacacacacagacacacgucuguauauuuuguauuuacacgacucu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI_Poptr2.0) Overlapping transcripts
scaffold_17: 12354617-12354855 [+]
intergenic

Mature sequence ptc-miR169f

Accession MIMAT0001962
Sequence

11 - 

cagccaaggaugacuugccgg

 - 31

Get sequence
Evidence by similarity; MI0000212

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).