Stem-loop sequence ptc-MIR169d

AccessionMI0002254
DescriptionPopulus trichocarpa miR169d stem-loop
Gene family MIPF0000037; MIR169_2
Stem-loop
gag       c         ug          auuuccuc        c     cg 
   ucgaaug agccaagga  acuugccggc        cuaaguag gagcc  g
   ||||||| |||||||||  ||||||||||        |||||||| |||||   
   gguuuau ucgguuccu  ugggcggccg        gguuuauc uucgg  c
--u       a         gu          gcccgcac        -     aa 
Get sequence
Deep sequencing
66 reads, 178 reads per million, 2 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI_Poptr2.0) Overlapping transcripts
scaffold_6: 5569290-5569400 [-]
intergenic

Mature sequence ptc-miR169d

Accession MIMAT0001960
Sequence

11 - 

cagccaaggaugacuugccgg

 - 31

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence by similarity; MI0000212

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).