Stem-loop sequence ptc-MIR169b

AccessionMI0002252
DescriptionPopulus trichocarpa miR169b stem-loop
Gene family MIPF0000037; MIR169_2
Stem-loop
aa  uu    c         ug           -ac        g   ccaucaaua 
  ga  gaug agccaagga  acuugccgacg   ucguuuuu cuu         u
  ||  |||| |||||||||  |||||||||||   |||||||| |||          
  cu  uuac ucgguucuu  uggacgguugc   aguagaga gaa         a
--  uu    a         gu           cua        a   uuaauacgc 
Get sequence
Deep sequencing
384 reads, 539 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI_Poptr2.0) Overlapping transcripts
scaffold_13: 4145219-4145331 [+]
intergenic

Mature sequence ptc-miR169b-5p

Accession MIMAT0001958
Previous IDsptc-miR169b
Sequence

11 - 

cagccaaggaugacuugccga

 - 31

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; miRNAseq [2]

Mature sequence ptc-miR169b-3p

Accession MIMAT0022898
Sequence

87 - 

ggcagguuguucuuggcuac

 - 106

Get sequence
Deep sequencing316 reads, 3 experiments
Evidence experimental; miRNAseq [2]

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).
2
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).