Stem-loop sequence ptc-MIR169b

AccessionMI0002252 (change log)
DescriptionPopulus trichocarpa miR169b stem-loop
Gene family MIPF0000037; MIR169_2
Stem-loop
   aa  uu    c         ug           -ac        g   ccaucaaua 
5'   ga  gaug agccaagga  acuugccgacg   ucguuuuu cuu         u
     ||  |||| |||||||||  |||||||||||   |||||||| |||          
3'   cu  uuac ucgguucuu  uggacgguugc   aguagaga gaa         a
   --  uu    a         gu           cua        a   uuaauacgc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000349.2: 4145219-4145331 [+]
intergenic
Database links

Mature sequence ptc-miR169b-5p

Accession MIMAT0001958
Previous IDsptc-miR169b
Sequence

11 - 

cagccaaggaugacuugccga

 - 31

Get sequence
Evidence experimental; miRNAseq [2]

Mature sequence ptc-miR169b-3p

Accession MIMAT0022898
Sequence

87 - 

ggcagguuguucuuggcuac

 - 106

Get sequence
Evidence experimental; miRNAseq [2]

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).
2
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).