Stem-loop sequence ptc-MIR169ad

AccessionMI0002249 (change log)
DescriptionPopulus trichocarpa miR169ad stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

9 open access papers mention ptc-MIR169ad
(12 sentences)

Stem-loop
   guugu     --         c     g    -c    --     ca   g    g 
5'      ucggu  agccaagga gacuu ccca  acua  ugaga  agu guua a
        |||||  ||||||||| ||||| ||||  ||||  |||||  ||| ||||  
3'      agucg  ucgguuccu cugaa gggu  uggu  auucu  uca cgau a
   ----c     ua         -     -    au    ua     --   a    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000343.2: 6019640-6019740 [-]
intergenic
Clustered miRNAs
< 10kb from ptc-MIR169ad
ptc-MIR169xCM000343.2: 6023427-6023544 [-]
ptc-MIR169adCM000343.2: 6019640-6019740 [-]
ptc-MIR169abCM000343.2: 6018895-6019001 [-]
Database links

Mature sequence ptc-miR169ad

Accession MIMAT0001955
Sequence

10 - 

uagccaaggacgacuugccca

 - 30

Get sequence
Evidence by similarity; MI0000212

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).