Stem-loop sequence ptc-MIR169ab

AccessionMI0002247 (change log)
DescriptionPopulus trichocarpa miR169ab stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

9 open access papers mention ptc-MIR169ab
(12 sentences)

Stem-loop
   cauguuuggcagccaaggaagacuugcccgucauc   uu        cca    auua     c   uuu 
5'                                    guc  agcugguu   gugu    cuuag acc   u
                                      |||  ||||||||   ||||    ||||| |||    
3'                                    cag  ucgaucag   cacg    ggguu ugg   g
   ----------------------------------a   --        uuc    -aag     u   uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000343.2: 6018895-6019001 [-]
intergenic
Clustered miRNAs
< 10kb from ptc-MIR169ab
ptc-MIR169xCM000343.2: 6023427-6023544 [-]
ptc-MIR169adCM000343.2: 6019640-6019740 [-]
ptc-MIR169abCM000343.2: 6018895-6019001 [-]
Database links

Mature sequence ptc-miR169ab

Accession MIMAT0001953
Sequence

10 - 

cagccaaggaagacuugccc

 - 29

Get sequence
Evidence by similarity; MI0000212

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).