Stem-loop sequence ptc-MIR169aa

AccessionMI0002246 (change log)
DescriptionPopulus trichocarpa miR169aa stem-loop
Gene family MIPF0000253; MIR169_3
Literature search

9 open access papers mention ptc-MIR169aa
(12 sentences)

Stem-loop
   g     auc                 u   ------  gg      -----      a g 
5'  uagag   gagccaagaaugacuug cgg      ca  cuagca     auugcu c u
    |||||   ||||||||||||||||| |||      ||  ||||||     |||||| | a
3'  guuuc   cucgguucuugcuggac gcc      gu  gaucgu     uaacga g u
   -     -aa                 c   uuauga  aa      augua      - a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ptc-miR169aa

Accession MIMAT0001952
Sequence

10 - 

gagccaagaaugacuugucgg

 - 30

Get sequence
Evidence by similarity; MI0000976

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).