Stem-loop sequence ptc-MIR169a

AccessionMI0002245 (change log)
DescriptionPopulus trichocarpa miR169a stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

9 open access papers mention ptc-MIR169a
(14 sentences)

Stem-loop
   aa ug     c     a   ug           --ua    aucu   uaaauuaaugcauguguagucaaaauuacuacuac 
5'   g  guaug agcca gga  acuugccgacu    acug    gua                                   u
     |  ||||| ||||| |||  |||||||||||    ||||    |||                                   a
3'   c  cguac ucggu ccu  ugaacgguuga    ugau    cau                                   u
   -- gu     a     a   gu           uuaa    cgau   caaucaauuaaacaccagugucuagucuaauuaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000337.2: 3089790-3089954 [-]
intergenic
Database links

Mature sequence ptc-miR169a

Accession MIMAT0001951
Sequence

11 - 

cagccaaggaugacuugccga

 - 31

Get sequence
Evidence by similarity; MI0000212

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).