Stem-loop sequence ptc-MIR167h

AccessionMI0002242 (change log)
DescriptionPopulus trichocarpa miR167h stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

7 open access papers mention ptc-MIR167h
(50 sentences)

Stem-loop
   cgcuau   u           a         ag       uaauuu 
5'       uag ugaagcugcca caugaucug  cuuuccu      u
         ||| ||||||||||| |||||||||  |||||||       
3'       auc acuuugacggu guacuagau  gaaagga      c
   --aguu   c           -         ca       cauauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000349.2: 2408396-2408486 [+]
intergenic
Database links

Mature sequence ptc-miR167h-5p

Accession MIMAT0001948
Previous IDsptc-miR167h
Sequence

11 - 

ugaagcugccaacaugaucug

 - 31

Get sequence
Evidence experimental; miRNAseq [2]

Mature sequence ptc-miR167h-3p

Accession MIMAT0022895
Sequence

65 - 

agaucauguggcaguuucacc

 - 85

Get sequence
Evidence experimental; miRNAseq [2]

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).
2
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).