Stem-loop sequence ptc-MIR167g

AccessionMI0002241 (change log)
DescriptionPopulus trichocarpa miR167g stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

6 open access papers mention ptc-MIR167g
(47 sentences)

Stem-loop
   c   a    u           g        uaaccuc    cu 
5'  acu ucag ugaagcugcca caugaucu       ccuc  u
    ||| |||| ||||||||||| ||||||||       ||||  u
3'  uga aguc acuuugacggu guacuaga       ggag  g
   -   -    c           -        caagaaa    cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000344.2: 10561904-10561989 [+]
intergenic
Database links

Mature sequence ptc-miR167g-5p

Accession MIMAT0001947
Previous IDsptc-miR167g
Sequence

11 - 

ugaagcugccagcaugaucuu

 - 31

Get sequence
Evidence experimental; miRNAseq [2]

Mature sequence ptc-miR167g-3p

Accession MIMAT0022894
Sequence

60 - 

agaucauguggcaguuucacc

 - 80

Get sequence
Evidence experimental; miRNAseq [2]

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).
2
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).