Stem-loop sequence ptc-MIR167e

AccessionMI0002239 (change log)
DescriptionPopulus trichocarpa miR167e stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

6 open access papers mention ptc-MIR167e
(53 sentences)

Stem-loop
   cac      u           g         aa       uaauuu 
5'    uaguag ugaagcugcca caugaucug  cuuuccu      u
      |||||| ||||||||||| |||||||||  |||||||       
3'    guuauc acuuugauggu guacuagau  gaaaggg      c
   --a      u           -         ca       cauauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000341.2: 3575879-3575969 [+]
intergenic
Database links

Mature sequence ptc-miR167e

Accession MIMAT0001945
Sequence

11 - 

ugaagcugccagcaugaucug

 - 31

Get sequence
Evidence by similarity; MI0000208

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).