Stem-loop sequence ptc-MIR167b

AccessionMI0002236 (change log)
DescriptionPopulus trichocarpa miR167b stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

6 open access papers mention ptc-MIR167b
(50 sentences)

Stem-loop
   ag    aa     a    - -            u  uu      agaaa 
5'   ggaa  aguga gcug c cagcaugaucua cu  gguuag     g
     ||||  ||||| |||| | |||||||||||| ||  ||||||      
3'   ccuu  ucacu cgac g gucguacuggau ga  ccaauc     a
   --    cc     c    a u            c  uc      aggaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000338.2: 3064788-3064883 [-]
intergenic
Clustered miRNAs
< 10kb from ptc-MIR167b
ptc-MIR167bCM000338.2: 3064788-3064883 [-]
ptc-MIR167aCM000338.2: 3062198-3062286 [-]
Database links

Mature sequence ptc-miR167b

Accession MIMAT0001942
Sequence

11 - 

ugaagcugccagcaugaucua

 - 31

Get sequence
Evidence by similarity; MI0000209

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).