Stem-loop sequence ptc-MIR167a

AccessionMI0002235 (change log)
DescriptionPopulus trichocarpa miR167a stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

6 open access papers mention ptc-MIR167a
(51 sentences)

Stem-loop
   cac      u      ug   g          --  -      cuu 
5'    uagcag ugaagc  cca caugaucuaa  cu uccuug   c
      |||||| ||||||  ||| ||||||||||  || ||||||   u
3'    guuguc acuuug  ggu guacuagauu  gg aggaac   u
   --a      c      gu   -          ua  u      uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000338.2: 3062198-3062286 [-]
intergenic
Clustered miRNAs
< 10kb from ptc-MIR167a
ptc-MIR167bCM000338.2: 3064788-3064883 [-]
ptc-MIR167aCM000338.2: 3062198-3062286 [-]
Database links

Mature sequence ptc-miR167a

Accession MIMAT0001941
Sequence

11 - 

ugaagcugccagcaugaucua

 - 31

Get sequence
Evidence by similarity; MI0000208

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).