Stem-loop sequence ptc-MIR166q

AccessionMI0002234 (change log)
DescriptionPopulus trichocarpa miR166q stem-loop
Gene family MIPF0000004; MIR166
Literature search

6 open access papers mention ptc-MIR166q
(23 sentences)

Stem-loop
   uuag    ag       uu      cu     -         -c  u   -         auggcauuaccugaug 
5'     guug  aggaaug  gucugg  cgagg ucauugagg  ca gau uauacagac                a
       ||||  |||||||  ||||||  ||||| |||||||||  || ||| |||||||||                c
3'     caac  uccuuac  cggacc  gcucu aguagcucc  gu cua gugugucug                a
   -aaa    cu       uu      ag     u         au  u   u         aaacuuaaaagagccg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000343.2: 3116836-3116986 [-]
intergenic
Clustered miRNAs
< 10kb from ptc-MIR166q
ptc-MIR166fCM000343.2: 3117083-3117187 [-]
ptc-MIR166qCM000343.2: 3116836-3116986 [-]
Database links

Mature sequence ptc-miR166q

Accession MIMAT0001940
Sequence

123 - 

ucggaccaggcuucauuccuu

 - 143

Get sequence
Evidence by similarity; MI0000203

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).