Stem-loop sequence ptc-MIR166p

AccessionMI0002233 (change log)
DescriptionPopulus trichocarpa miR166p stem-loop
Gene family MIPF0000004; MIR166
Literature search

6 open access papers mention ptc-MIR166p
(23 sentences)

Stem-loop
   uaa     ag     c cu      gu     -    gg  gccaugauuauacauaaauggcauuaucugau 
5'    gguug  aggaa g  gucugg  cgagg ucau  ag                                g
      |||||  ||||| |  ||||||  ||||| ||||  ||                                 
3'    ccaac  uccuu c  cggacc  gcucu agua  uc                                a
   -ua     cu     a cu      ag     u    aa  caaguucuguccacguagcuaauagacccgac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000341.2: 4841446-4841591 [-]
intergenic
Clustered miRNAs
< 10kb from ptc-MIR166p
ptc-MIR166dCM000341.2: 4841691-4841795 [-]
ptc-MIR166pCM000341.2: 4841446-4841591 [-]
Database links

Mature sequence ptc-miR166p

Accession MIMAT0001939
Sequence

118 - 

ucggaccaggcuccauuccuu

 - 138

Get sequence
Evidence by similarity; MI0000204

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).