Stem-loop sequence ptc-MIR166p

Accession MI0002233
Description Populus trichocarpa miR166p stem-loop
Gene family MIPF0000004; MIR166
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-166_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The plant mir-166 microRNA precursor is a small non-coding RNA gene. This microRNA (miRNA) has now been predicted or experimentally confirmed in a wide range of plant species. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The mature products are thought to have regulatory roles through complementarity to messenger RNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
uaa     ag     c cu      gu     -    gg  gccaugauuauacauaaauggcauuaucugau 
   gguug  aggaa g  gucugg  cgagg ucau  ag                                g
   |||||  ||||| |  ||||||  ||||| ||||  ||                                 
   ccaac  uccuu c  cggacc  gcucu agua  uc                                a
-ua     cu     a cu      ag     u    aa  caaguucuguccacguagcuaauagacccgac 
Get sequence
Genome context
Coordinates (JGI_Poptr2.0) Overlapping transcripts
scaffold_5: 4841446-4841591 [-]
intergenic
Clustered miRNAs
< 10kb from ptc-MIR166p
ptc-MIR166d scaffold_5: 4841691-4841795 [-]
ptc-MIR166p scaffold_5: 4841446-4841591 [-]

Mature sequence ptc-miR166p

Accession MIMAT0001939
Sequence

118 - 

ucggaccaggcuccauuccuu

 - 138

Get sequence
Evidence by similarity; MI0000204

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).