Stem-loop sequence ptc-MIR166l

AccessionMI0002229 (change log)
DescriptionPopulus trichocarpa miR166l stem-loop
Gene family MIPF0000004; MIR166
Literature search

6 open access papers mention ptc-MIR166l
(23 sentences)

Stem-loop
   uaacuu   u  u     uu         a   -    --gc     ca 
5'       uug gg gaaug  gucugguuc agg caug    cacca  u
         ||| || |||||  ||||||||| ||| ||||    |||||  c
3'       aac cc cuuac  cggaccagg ucc guau    guggu  u
   -uaauu   u  c     uu         c   u    auaa     uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000351.2: 541777-541873 [-]
intergenic
Database links

Mature sequence ptc-miR166l

Accession MIMAT0001935
Sequence

68 - 

ucggaccaggcuucauucccc

 - 88

Get sequence
Evidence by similarity; MI0000199

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).