Stem-loop sequence ptc-MIR166h

AccessionMI0002225 (change log)
DescriptionPopulus trichocarpa miR166h stem-loop
Gene family MIPF0000004; MIR166
Literature search

6 open access papers mention ptc-MIR166h
(23 sentences)

Stem-loop
   acac     a        cu     a       c     acuuuaagcac 
5'     aguug ggggaaug  gucug uucgaga cauuc           a
       ||||| ||||||||  ||||| ||||||| |||||            
3'     ucaac ccccuuac  cggac aggcucu guaag           c
   -aac     c        uu     c       a     cuuucuacuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000346.2: 9569645-9569745 [+]
intergenic
Database links

Mature sequence ptc-miR166h

Accession MIMAT0001931
Sequence

72 - 

ucggaccaggcuucauucccc

 - 92

Get sequence
Evidence by similarity; MI0000206

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).