Stem-loop sequence ptc-MIR166g

AccessionMI0002224 (change log)
DescriptionPopulus trichocarpa miR166g stem-loop
Gene family MIPF0000004; MIR166
Literature search

6 open access papers mention ptc-MIR166g
(23 sentences)

Stem-loop
   acac     a        cu             c      ---cc    -  g 
5'     aguug ggggaaug  gucugguucgaga cauuca     ugaa gc c
       ||||| ||||||||  ||||||||||||| ||||||     |||| ||  
3'     ucaac ccccuuac  cggaccaggcucu gugagu     acuu cg a
   -aac     c        uu             a      uuucu    a  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000344.2: 10886852-10886954 [-]
intergenic
Database links

Mature sequence ptc-miR166g

Accession MIMAT0001930
Sequence

74 - 

ucggaccaggcuucauucccc

 - 94

Get sequence
Evidence by similarity; MI0000206

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).