Stem-loop sequence ptc-MIR166c

AccessionMI0002220 (change log)
DescriptionPopulus trichocarpa miR166c stem-loop
Gene family MIPF0000004; MIR166
Literature search

6 open access papers mention ptc-MIR166c
(23 sentences)

Stem-loop
   cuuuuu   a        uu      cu   g      uucuugaucagucugaucaaguguucua 
5'       uug ggggaaug  gucugg  cga gacucu                            u
         ||| ||||||||  ||||||  ||| ||||||                            c
3'       aac ccccuuac  cggacc  gcu cuggga                            u
   -uuauu   c        uu      ag   g      uuguguacuagauucuauaaucuagauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000338.2: 13513492-13513625 [+]
intergenic
Database links

Mature sequence ptc-miR166c

Accession MIMAT0001926
Sequence

105 - 

ucggaccaggcuucauucccc

 - 125

Get sequence
Evidence by similarity; MI0000202

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).