Stem-loop sequence ptc-MIR166b

AccessionMI0002219 (change log)
DescriptionPopulus trichocarpa miR166b stem-loop
Gene family MIPF0000004; MIR166
Literature search

6 open access papers mention ptc-MIR166b
(23 sentences)

Stem-loop
   uaacu    a     u  cu           u        u   aa  u   a 
5'      guug gggga ug  gucugguucga gucauuca gug  gc uua c
        |||| ||||| ||  ||||||||||| |||||||| |||  || |||  
3'      caac ccccu ac  cggaccaggcu uagugagu uau  ug aau a
   -auau    c     u  uu           u        -   ga  u   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000338.2: 2744789-2744894 [+]
intergenic
Database links

Mature sequence ptc-miR166b

Accession MIMAT0001925
Sequence

77 - 

ucggaccaggcuucauucccc

 - 97

Get sequence
Evidence by similarity; MI0000207

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).