Stem-loop sequence ptc-MIR164f

AccessionMI0002217 (change log)
DescriptionPopulus trichocarpa miR164f stem-loop
Gene family MIPF0000045; MIR164
Literature search

8 open access papers mention ptc-MIR164f
(38 sentences)

Stem-loop
   ugag   u        a c           u   u       -  u 
5'     cca gcuggaga g agggcacaugc aaa cuaucag cu g
       ||| |||||||| | ||||||||||| ||| ||||||| ||  
3'     ggu cgaccucu u ucucguguacg uuu gauaguc ga a
   --ca   u        c a           -   u       u  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000339.2: 8307292-8307381 [+]
intergenic
Database links

Mature sequence ptc-miR164f

Accession MIMAT0001923
Sequence

11 - 

uggagaagcagggcacaugcu

 - 31

Get sequence
Evidence by similarity; MI0002212

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).
2
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).