Stem-loop sequence ptc-MIR164a

AccessionMI0002212 (change log)
DescriptionPopulus trichocarpa miR164a stem-loop
Gene family MIPF0000045; MIR164
Literature search

9 open access papers mention ptc-MIR164a
(42 sentences)

Stem-loop
   ggu   u  c        c     a       aauccugauga    c 
5'    ucc ug uggagaag agggc cgugcaa           agug u
      ||| || |||||||| ||||| |||||||           ||||  
3'    ggg ac accucuuc ucucg gcacguu           ucac u
   --c   c  a        u     c       -----------    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000338.2: 16570527-16570611 [+]
intergenic
Database links

Mature sequence ptc-miR164a

Accession MIMAT0001918
Sequence

11 - 

uggagaagcagggcacgugca

 - 31

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).
2
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).