Stem-loop sequence ptc-MIR162b

AccessionMI0002210 (change log)
DescriptionPopulus trichocarpa miR162b stem-loop
Gene family MIPF0000127; MIR162_1
Literature search

2 open access papers mention ptc-MIR162b
(8 sentences)

Stem-loop
   uga    a       g    c    c       uu   c  aagauuuuu      u 
5'    gaag cacugga gcag gguu aucgauc  uuc ug         uuguuu a
      |||| ||||||| |||| |||| |||||||  ||| ||         |||||| c
3'    cuuc gugaccu cguc ccaa uagcuag  aag ac         aacaag a
   ucc    -       a    u    a       cc   c  ---------      c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000351.2: 6727251-6727357 [+]
intergenic
Database links

Mature sequence ptc-miR162b

Accession MIMAT0001916
Sequence

78 - 

ucgauaaaccucugcauccag

 - 98

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).
2
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
3
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).