Stem-loop sequence ptc-MIR160g

AccessionMI0002207 (change log)
DescriptionPopulus trichocarpa miR160g stem-loop
Gene family MIPF0000032; MIR160
Literature search

6 open access papers mention ptc-MIR160g
(22 sentences)

Stem-loop
   --g    caau    c       -   g          a   auuu      u 
5'    ggau    cugc uggcucc cug augccaacua gaa    gucgag g
      ||||    |||| ||||||| ||| |||||||||| |||    ||||||  
3'    ccug    gacg acugagg gac uacgguugau cuu    caguuc g
   caa    ----    u       a   -          a   --cu      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000350.2: 13103115-13103212 [-]
intergenic
Database links

Mature sequence ptc-miR160g

Accession MIMAT0001913
Sequence

11 - 

ugccuggcucccuggaugcca

 - 31

Get sequence
Evidence by similarity; MI0002202

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).
2
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).