Stem-loop sequence ptc-MIR160f

AccessionMI0002206 (change log)
DescriptionPopulus trichocarpa miR160f stem-loop
Gene family MIPF0000032; MIR160
Literature search

6 open access papers mention ptc-MIR160f
(22 sentences)

Stem-loop
   aagaau       c         ga      uc   ga  c       ag 
5'       ggucugc uggcucccu  augcca  uag  ag uugucaa  a
         ||||||| |||||||||  ||||||  |||  || |||||||   
3'       ccggacg acugagggg  uacggu  auc  uc aacgguu  g
   --caac       c         ag      ca   uc  c       gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000352.2: 120174-120273 [+]
intergenic
Database links

Mature sequence ptc-miR160f

Accession MIMAT0001912
Sequence

11 - 

ugccuggcucccugaaugcca

 - 31

Get sequence
Evidence by similarity; MI0002202

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).
2
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).