Stem-loop sequence ptc-MIR160e

AccessionMI0002205 (change log)
DescriptionPopulus trichocarpa miR160e stem-loop
Gene family MIPF0000032; MIR160
Literature search

6 open access papers mention ptc-MIR160e
(22 sentences)

Stem-loop
   aagaa        c         ga      uc       c       ag 
5'      uggccugc uggcucccu  augcca  uaggaag uugucaa  a
        |||||||| |||||||||  ||||||  ||||||| |||||||   
3'      accggacg gcugagggg  uacggu  aucuuuc aacgguu  g
   --uua        a         ag      uu       c       gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000342.2: 167623-167722 [+]
intergenic
Database links

Mature sequence ptc-miR160e-5p

Accession MIMAT0001911
Previous IDsptc-miR160e
Sequence

11 - 

ugccuggcucccugaaugcca

 - 31

Get sequence
Evidence experimental; miRNAseq [3]

Mature sequence ptc-miR160e-3p

Accession MIMAT0022892
Sequence

74 - 

gcaugaggggagucgagcagg

 - 94

Get sequence
Evidence experimental; miRNAseq [3]

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).
2
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).
3
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).