Stem-loop sequence ptc-MIR160b

AccessionMI0002202 (change log)
DescriptionPopulus trichocarpa miR160b stem-loop
Gene family MIPF0000032; MIR160
Literature search

6 open access papers mention ptc-MIR160b
(22 sentences)

Stem-loop
   auauuau      c       cu          ug a   c   a   a 
5'        augugc uggcucc  guaugccauu  c gag cca cgg u
          |||||| |||||||  ||||||||||  | ||| ||| |||  
3'        uauacg accgagg  uaugcgguag  g cuc ggu gcu c
   --acgcu      u       ag          gu c   c   a   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000344.2: 2253371-2253468 [-]
intergenic
Database links

Mature sequence ptc-miR160b-5p

Accession MIMAT0001908
Previous IDsptc-miR160b
Sequence

11 - 

ugccuggcucccuguaugcca

 - 31

Get sequence
Evidence experimental; cloned [1], miRNAseq [4]

Mature sequence ptc-miR160b-3p

Accession MIMAT0022890
Sequence

72 - 

gcguaugaggagccaugcaua

 - 92

Get sequence
Evidence experimental; miRNAseq [4]

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).
2
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
3
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).
4
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).