Stem-loop sequence ptc-MIR159c

AccessionMI0002200 (change log)
DescriptionPopulus trichocarpa miR159c stem-loop
Gene family MIPF0000010; MIR159
Literature search

9 open access papers mention ptc-MIR159c
(47 sentences)

Stem-loop
   -      ca  g        cc       -   cu      a   cgau   a       g  g    u     aau        -g       aauua  aacg 
5'  gaggcu  au gagcucuc  cacucca ugc  gaaagg guu    ggu gaccaug cu cuag ucaug   acccuugg  ugcgcag     gc    g
    ||||||  || ||||||||  ||||||| |||  |||||| |||    ||| ||||||| || |||| |||||   ||||||||  |||||||     ||     
3'  uucugg  ua cucgaggg  gugaggu aug  uuuucc cag    cca uuggugc ga gauc aguac   ugggaauc  acgcguu     cg    u
   u      --  g        aa       u   -u      -   --uc   -       a  g    c     guc        gg       -gaag  gacg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ptc-miR159c

Accession MIMAT0001906
Sequence

173 - 

auuggagugaagggagcucga

 - 193

Get sequence
Evidence by similarity; MI0001086

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).