Stem-loop sequence ptc-MIR159a

AccessionMI0002195 (change log)
DescriptionPopulus trichocarpa miR159a stem-loop
Gene family MIPF0000010; MIR159
Literature search

9 open access papers mention ptc-MIR159a
(75 sentences)

Stem-loop
   gauua   ag           ga       u     -u   u  --       auu     g  a  c    g -u  a   u       a  a 
5'      ggg  uggagcuccuu  aguccaa agagg  ucu gc  uggguag   aagcu cu ag uaug a  cc cag ccuaucu uc a
        |||  |||||||||||  ||||||| |||||  ||| ||  |||||||   ||||| || || |||| |  || ||| ||||||| ||  
3'      ccc  aucucgaggga  uuagguu uuucc  aga ug  auccguu   uucga ga uc auac u  gg guu ggauagg ag c
   -aaua   aa           ag       -     cu   u  ua       -au     g  c  u    g uc  c   u       a  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000348.2: 4086335-4086517 [-]
intergenic
Database links

Mature sequence ptc-miR159a

Accession MIMAT0001901
Sequence

154 - 

uuuggauugaagggagcucua

 - 174

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).
2
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).