Stem-loop sequence ptc-MIR156h

AccessionMI0002191 (change log)
DescriptionPopulus trichocarpa miR156h stem-loop
Gene family MIPF0000008; MIR156
Literature search

8 open access papers mention ptc-MIR156h
(77 sentences)

Stem-loop
   ----     ugcugu           -         u  c  -   a     ugga 
5'     gguga      ugacagaagau agagagcac ga ga uga augca    g
       |||||      ||||||||||| ||||||||| || || ||| |||||    c
3'     ccacu      acugucuucug ucucucgug uu cu acu uacgu    u
   acuu     ------           a         u  c  c   c     uaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000340.2: 7938832-7938934 [-]
intergenic
Database links

Mature sequence ptc-miR156h

Accession MIMAT0001897
Sequence

11 - 

uugacagaagauagagagcac

 - 31

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).
2
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
3
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).