Stem-loop sequence ptc-MIR156e

AccessionMI0002188 (change log)
DescriptionPopulus trichocarpa miR156e stem-loop
Gene family MIPF0000008; MIR156
Literature search

8 open access papers mention ptc-MIR156e
(77 sentences)

Stem-loop
   cauua   a         -    -        a        uauuu     a 
5'      gaa cugacagaa gaga gugagcac cagaggca     guaua a
        ||| ||||||||| |||| |||||||| ||||||||     |||||  
3'      cuu gacugucuu cucu cacucgug guuuucgu     cauau u
   -agac   c         a    u        c        --uac     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ptc-miR156e

Accession MIMAT0001894
Sequence

11 - 

ugacagaagagagugagcac

 - 30

Get sequence
Evidence by similarity; MI0002193

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).
2
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).