Stem-loop sequence ptc-MIR156d

AccessionMI0002187 (change log)
DescriptionPopulus trichocarpa miR156d stem-loop
Gene family MIPF0000008; MIR156
Literature search

8 open access papers mention ptc-MIR156d
(77 sentences)

Stem-loop
   guaa   a u       -    a   a    a      acu   uu     a 
5'     gug g ugacaga agag gug gcac cagggu   uuc  gcaug c
       ||| | ||||||| |||| ||| |||| ||||||   |||  ||||| g
3'     uac c acugucu ucuc cac cgug guuucg   aag  cguac u
   --ac   c c       a    c   c    c      ---   uu     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ptc-miR156d

Accession MIMAT0001893
Sequence

11 - 

ugacagaagagagugagcac

 - 30

Get sequence
Evidence by similarity; MI0002190

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).
2
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
3
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).