Stem-loop sequence ptc-MIR156b

AccessionMI0002185 (change log)
DescriptionPopulus trichocarpa miR156b stem-loop
Gene family MIPF0000008; MIR156
Literature search

8 open access papers mention ptc-MIR156b
(78 sentences)

Stem-loop
   guaag  a         -             a      acu   uu     a 
5'      gg ggugacaga agagagugagcac cagggu   uuc  gcaug c
        || ||||||||| ||||||||||||| ||||||   |||  ||||| a
3'      cc ccacugucu ucucucacucgug guuuca   aag  cguac u
   -acca  -         a             c      ---   uu     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000342.2: 22869899-22869999 [-]
intergenic
Database links

Mature sequence ptc-miR156b

Accession MIMAT0001891
Sequence

11 - 

ugacagaagagagugagcac

 - 30

Get sequence
Evidence by similarity; MI0000183

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).