Stem-loop sequence ptc-MIR156a

AccessionMI0002184 (change log)
DescriptionPopulus trichocarpa miR156a stem-loop
Gene family MIPF0000008; MIR156
Literature search

8 open access papers mention ptc-MIR156a
(83 sentences)

Stem-loop
   aaa a   a             -            gaaa   u    u   a 
5'    g aag cugacagaagaga gugagcacacac    gua augg aug a
      | ||| ||||||||||||| ||||||||||||    ||| |||| |||  
3'    c uuc gacugucuucucu cacucgugugug    cgu uacc uac g
   -ca c   -             a            -gga   -    u   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000342.2: 19089414-19089514 [-]
intergenic
Database links

Mature sequence ptc-miR156a

Accession MIMAT0001890
Sequence

11 - 

ugacagaagagagugagcac

 - 30

Get sequence
Evidence by similarity; MI0000179

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).