Stem-loop sequence dre-mir-457b

AccessionMI0002178 (change log)
DescriptionDanio rerio miR-457b stem-loop
Gene family MIPF0000006; mir-15
Literature search

2 open access papers mention dre-mir-457b
(3 sentences)

Stem-loop
   gaaug     a     c   ua         gg    ug 
5'      uacua agcag aca  aauacugga  ugau  u
        ||||| ||||| |||  |||||||||  ||||   
3'      augau ucguc ugu  uuaugaccu  auug  g
   ccaga     g     u   cg         --    ug 
Get sequence
Deep sequencing
1379 reads, 90 reads per million, 10 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr14: 31521930-31522007 [-]
intergenic
KZ115452.1: 78034-78111 [-]
intergenic
Database links

Mature sequence dre-miR-457b-5p

Accession MIMAT0001884
Previous IDsdre-miR-457b
Sequence

11 - 

aagcagcacauaaauacuggag

 - 32

Get sequence
Deep sequencing1087 reads, 10 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-457b-3p

Accession MIMAT0032004
Sequence

48 - 

uccaguauugcuguucugcugu

 - 69

Get sequence
Deep sequencing281 reads, 10 experiments
Evidence not experimental
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).