Stem-loop sequence dre-mir-457a

AccessionMI0002177 (change log)
DescriptionDanio rerio miR-457a stem-loop
Gene family MIPF0000006; mir-15
Literature search

2 open access papers mention dre-mir-457a
(4 sentences)

Stem-loop
   ugc     a a         -uca         gcu    uc 
5'    cugac g agcagcaca    auauuggca   gccc  u
      ||||| | |||||||||    |||||||||   ||||  c
3'    gacug c ucgucgugu    uaugaccgu   uggg  u
   aca     c c         uugg         ---    uc 
Get sequence
Deep sequencing
8944 reads, 800 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr7: 26071426-26071508 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-457a
dre-mir-15bchr7: 26070874-26071007 [+]
dre-mir-457achr7: 26071426-26071508 [+]
Database links

Mature sequence dre-miR-457a

Accession MIMAT0001883
Sequence

11 - 

aagcagcacaucaauauuggca

 - 32

Get sequence
Deep sequencing8818 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).