Stem-loop sequence dre-mir-430i-1

AccessionMI0002139 (change log)
DescriptionDanio rerio miR-430i-1 stem-loop
Gene family MIPF0000003; mir-430
Literature search

38 open access papers mention dre-mir-430i-1
(186 sentences)

Stem-loop
      u  -auc g   -  uc     -      g   uu      
5' guc cu    g uac cc  acaaa agcacu acu  gaugc 
   ||| ||    | ||| ||  ||||| |||||| |||  |||| u
3' cag ga    u aug gg  uguuu ucguga ugg  uuaug 
      u  acuu g   c  -u     a      a   -u      
Get sequence
Deep sequencing
2794781 reads, 9.49e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr4: 28699661-28699742 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-430i-1
dre-mir-430a-18chr4: 28693199-28693288 [+]
dre-mir-430c-1chr4: 28693371-28693443 [+]
dre-mir-430b-4chr4: 28693628-28693708 [+]
dre-mir-430a-4chr4: 28693834-28693915 [+]
dre-mir-430c-2chr4: 28693975-28694047 [+]
dre-mir-430b-5chr4: 28694219-28694299 [+]
dre-mir-430a-2chr4: 28694950-28695031 [+]
dre-mir-430c-3chr4: 28695113-28695185 [+]
dre-mir-430b-10chr4: 28695370-28695450 [+]
dre-mir-430a-12chr4: 28695576-28695657 [+]
dre-mir-430c-4chr4: 28695717-28695789 [+]
dre-mir-430b-1chr4: 28695960-28696040 [+]
dre-mir-430a-3chr4: 28696691-28696772 [+]
dre-mir-430c-5chr4: 28696854-28696926 [+]
dre-mir-430b-6chr4: 28697111-28697191 [+]
dre-mir-430a-13chr4: 28697317-28697398 [+]
dre-mir-430c-6chr4: 28697458-28697530 [+]
dre-mir-430b-11chr4: 28697715-28697795 [+]
dre-mir-430a-16chr4: 28697921-28698002 [+]
dre-mir-430b-9chr4: 28698305-28698385 [+]
dre-mir-430a-5chr4: 28699035-28699116 [+]
dre-mir-430c-7chr4: 28699198-28699270 [+]
dre-mir-430b-12chr4: 28699455-28699535 [+]
dre-mir-430i-1chr4: 28699661-28699742 [+]
dre-mir-430c-8chr4: 28699824-28699896 [+]
dre-mir-430b-2chr4: 28700067-28700147 [+]
dre-mir-430a-6chr4: 28700798-28700879 [+]
dre-mir-430c-9chr4: 28700961-28701033 [+]
dre-mir-430b-7chr4: 28701218-28701298 [+]
dre-mir-430a-11chr4: 28701424-28701505 [+]
dre-mir-430c-10chr4: 28701587-28701659 [+]
dre-mir-430b-13chr4: 28701844-28701924 [+]
dre-mir-430i-2chr4: 28702050-28702131 [+]
dre-mir-430c-11chr4: 28702213-28702285 [+]
dre-mir-430b-18chr4: 28702456-28702536 [+]
dre-mir-430a-7chr4: 28703187-28703268 [+]
dre-mir-430c-12chr4: 28703350-28703422 [+]
dre-mir-430b-14chr4: 28703607-28703687 [+]
dre-mir-430a-17chr4: 28703813-28703894 [+]
dre-mir-430b-20chr4: 28704197-28704277 [+]
dre-mir-430a-8chr4: 28704927-28705008 [+]
dre-mir-430c-13chr4: 28705090-28705162 [+]
dre-mir-430b-15chr4: 28705347-28705427 [+]
dre-mir-430i-3chr4: 28705553-28705634 [+]
dre-mir-430c-14chr4: 28705716-28705788 [+]
dre-mir-430b-19chr4: 28705959-28706039 [+]
dre-mir-430a-9chr4: 28706690-28706771 [+]
dre-mir-430c-15chr4: 28706853-28706925 [+]
dre-mir-430b-16chr4: 28707110-28707190 [+]
dre-mir-430a-14chr4: 28707316-28707397 [+]
dre-mir-430c-16chr4: 28707457-28707529 [+]
dre-mir-430b-3chr4: 28707700-28707780 [+]
dre-mir-430a-10chr4: 28708430-28708511 [+]
dre-mir-430c-17chr4: 28708593-28708665 [+]
dre-mir-430b-8chr4: 28708850-28708930 [+]
dre-mir-430a-15chr4: 28709056-28709137 [+]
dre-mir-430c-18chr4: 28709197-28709269 [+]
dre-mir-430b-17chr4: 28709454-28709534 [+]
Database links

Mature sequence dre-miR-430i-5p

Accession MIMAT0032003
Sequence

13 - 

acccucacaaaagcacugacu

 - 33

Get sequence
Deep sequencing15774 reads, 5 experiments
Evidence not experimental

Mature sequence dre-miR-430i-3p

Accession MIMAT0001880
Previous IDsdre-miR-430i
Sequence

50 - 

uaagugcuauuuguuggcguag

 - 71

Get sequence
Deep sequencing8368044 reads, 5 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).