Stem-loop sequence dre-mir-375-2

AccessionMI0002073 (change log)
DescriptionDanio rerio miR-375-2 stem-loop
Gene family MIPF0000114; mir-375
Literature search

8 open access papers mention dre-mir-375-2
(80 sentences)

Stem-loop
   u   c    c c    u     ac   c    u    --g a 
5'  gua uugu u acgu gagcc  acg acaa gccu   c g
    ||| |||| | |||| |||||  ||| |||| ||||   |  
3'  cgu gacg a ugcg cucgg  ugc uguu uggg   g a
   a   a    c u    -     cu   u    u    aaa u 
Get sequence
Deep sequencing
15999 reads, 745 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr9: 11571973-11572055 [-]
intergenic
Database links

Mature sequence dre-miR-375

Accession MIMAT0001876
Sequence

52 - 

uuuguucguucggcucgcguua

 - 73

Get sequence
Deep sequencing31929 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).