Stem-loop sequence dre-mir-375-1

AccessionMI0002072 (change log)
DescriptionDanio rerio miR-375-1 stem-loop
Gene family MIPF0000114; mir-375
Literature search

8 open access papers mention dre-mir-375-1
(80 sentences)

Stem-loop
   u          u    u     ac   c    u  a  ug 
5'  gcacuugcuu acgu gagcc  acg acaa ac ug  g
    |||||||||| |||| |||||  ||| |||| || ||   
3'  cgugaacgaa ugcg cucgg  ugc uguu ug ac  a
   a          u    -     cu   u    u  -  uu 
Get sequence
Deep sequencing
16055 reads, 745 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr6: 13800093-13800172 [-]
antisense
OTTDART00000054349 ; tmem198b-002; intron 3
ENSDART00000154793 ; tmem198b-002; intron 3
Database links

Mature sequence dre-miR-375

Accession MIMAT0001876
Sequence

49 - 

uuuguucguucggcucgcguua

 - 70

Get sequence
Deep sequencing31929 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).